Moreno-Espíndola, Ferrara-Guerrero, León-González, Rivera-Becerril, Mayorga-Reyes, and Pérez: Enzymatic activity and culturable bacteria diversity in rhizosphere of amaranth, as indicators of crop phenological changes

Amaranth is a plant of interest in farming due to its ability to adapt into arid and semi-arid climates, where it can grow and yield seed and substantial amounts of biomass. The seed, which is gluten-free and contains relatively high levels of lysine (Clouse et al. 2016), is widely appreciated in Mexico as a food and its leaves are suitable for human consumption and as forage because they provide high-quality protein (Barba de la Rosa et al. 2009). The amaranth species studied in the current investigation, Amaranthus hypochondriacus L., has been cultivated in the Valley of Mexico under semi-arid conditions. Despite its agronomic and nutritional attributes, little is known about the activity and diversity of microbial communities associated with amaranth roots.

One important function of all soil microorganisms comprises the decomposition of soil organic matter (SOM). Proteases are involved in the hydrolysis of peptide bonds to release nitrogen (N); phosphatases catalyze the hydrolysis of esters and anhydrides of phosphoric acid; cellulases hydrolyze cellulose into glucose; and chitinase is capable of hydrolyzing insoluble chitin into its oligo and monomeric components (Kuddus & Ahmad 2013, Gianfreda 2015). Dehydrogenases (DH) also play a significant role in decomposition of SOM.

Microbial activity can increase in certain rhizosphere microenvironments, such as rhizosheaths, which are highly stable structures shaped by the enmeshment of soil particles (sand, silt and organic matter) by root-hairs (Othman et al. 2004). A high proportion of active soil microorganisms in these microenvironments benefit from the cellular debris and compounds released by roots (Lesuffleur et al. 2007). In the rhizosheath, greater microbial activity would be expected than in bulk soil due to the accumulation of organic compounds (Gianfreda 2015). Rhizosheaths are commonly found in the roots of grasses, but have also been found in other cultivated plants, such as amaranth (Figure 1; Moreno-Espíndola et al. 2007). Since plant phenology influences quantity and quality of root exudates, which determine microbial communities in roots (Bencherif et al. 2016, Francioli et al. 2018), it is expected that plant phenology influences rhizosheath traits. Microorganisms living in the rhizosphere of sandy soils promoted the formation of stable macroaggregates (Moreno-Espíndola et al. 2007). Into this context, Moreno-Espíndola et al. (2013) reported the presence of a culturable bacterial community comprising 37 isolates from the amaranth rhizosheath. This community has high heterotrophic potential, which could be useful for improving the fertility of the regional farming systems. It has been demonstrated that soil bacteria (Bacillus and Burkholderia) promote growth and increase yield in grain of amaranth through higher plant P and N uptake (Pal 1998, Parra-Cota et al. 2014). For the development of sustainable systems, the understanding of the microbial processes in soils is required (Philippot et al. 2006), especially in soils in which rain-fed agriculture is practiced.

Figure 1

Rhizosheath of amaranth: Root-hairs adhering sand particles in a volcanic soil in the Valley of Mexico.


The aim of this work was to evaluate the potential activity of six enzymes (dehydrogenase, protease, acid and alkaline phosphatases, cellulase and chitinase) involved in the transformation of organic matter in rhizosheath soil and surrounding rhizosheath soil (soil not adhered by roots) of amaranth plants grown in a sandy soil. Likewise, 37 bacterial isolates obtained from amaranth rhizosheath soil were molecularly identified, as microorganisms which potentially perform these enzyme activities.

Materials and methods

Soil and experimental site. The experimental site is located in the Valley of Mexico (Tulyehualco, 19º 15’N, 99º 13”W, 2,280 m in altitude). The soil is an Entisol (Soil Survey Staff 2003), and is composed of volcanic ash and 70, 140, and 790 g kg-1 of clay, silt, and sand, respectively. The predominant minerals are pumice and feldspars, the climate is semi-arid, with an average annual precipitation of 537 mm, a mean temperature of 17.9 ºC (De León-González et al. 2006). In 2009, an experimental field was established with amaranth, which was subdivided into three plots of 12 m2 each. Amaranth was sown under rain-fed conditions, with minimum tillage. An application of a single dose of fertilizer (80-40-00, N-P-K) at the beginning of the flowering period was carried out.

Soil sampling. Sampling of rhizosheath soil and surrounding rhizosheath soil (or loose soil), included four cropping periods of amaranth: sowing, flowering, harvest, and post-harvest (0, 45, 90, and 120 days after sowing). Three soil-root monoliths, one per plant, were obtained with a PVC cylinder (25.5 cm diameter; 37.5 cm length) used as a soil core sampler (Moreno-Espíndola et al. 2007) during each sampling period. Rhizosheath soil was separated from roots using a dissecting needle. The loose soil was sampled 3 cm out near the soil-root monolith. The samples were preserved in sterile plastic bags at 4 ºC.

Soil-organic carbon, microbial-biomass carbon, and total nitrogen. Soil organic carbon (SOC) was measured by the Walkley & Black (1934) method, and total nitrogen (TN), by digestion with H2SO4 (Bremner & Mulvaney 1982). Microbial biomass carbon (Cmic) was measured using the chloroform-fumigation (Vance et al. 1987), and an automatic carbon analyzer (Shimadzu, TOC-VCSN).

Soil pH and soil-water content. The pH of the soil samples was measured potentiometrically (HANNA HI250) in a water-soil suspension (2.5:1). At each phenological stage, soil water content (SWC) (g 100 g-1) was determined in situ using a neutron probe (CNP® MC-1DR), by averaging six measurements obtained by introducing the probe every 5 cm into a depth of 0-30 cm.

Enzymatic activities. The enzymatic activities considered for evaluation were those of dehydrogenase (DH), acid (ACP) and alkaline (ALP) phosphatase, cellulase (CEL), chitinase (CHI), and protease (PRO). All these enzymes participate in processes of soil organic matter (SOM) decomposition. Measurement of the potential of each enzyme activity was performed following the spectrophotometric methods described by García et al. (2003). To determine all absorbances, a Shimadzu Dual-beam Spectrophotometer (Shimadzu UV-1700) was employed. Corresponding calibration curves were generated for each enzymatic activity and each test included a control and four replicates.

Molecular identification of bacterial isolates from amaranth rhizosheath. While enzymatic activity was determined in soils, 37 bacteria were isolated from the amaranth rhizosheath, and physiologically characterized (Moreno-Espíndola et al. 2013). These 37 bacterial isolates were subcultured for molecular identification. Genomic DNA was extracted using the ZRFungal/Bacterial DNA MiniPrepTM kit according to the manufacturer’s instructions. DNA quality was analyzed in a 2 % agarose gel, and quantification was achieved using a Nano-Drop spectrophotometer (Thermo). PCR amplification of the 16S rDNA fragment was performed using primers rD1 (5´AAGGAGGTGATCCAGCC3´) and fD1 (5´AGAGTTTGATCCTGGCTCAG3´) (Laguerre et al. 1994). The PCR mix per sample was as follows: template DNA (50 ng); primers rD1 and fD1 (0.1 μM each); 10X buffer; dNTP (20 μM); MgCl2 (1.5 μM), and Fermentas Taq polymerase (2 U). PCR was performed in a Biometra thermocycler under the following conditions: initial denaturation at 95 ºC for 5 min; 35 cycles of denaturation at 94 ºC for 1 min; annealing at 55 ºC for 1 min, and extension at 72 ºC for 2 min; finally, an extension step at 72 ºC for 3 min. PCR products of approximately 1,500 bp were verified in a 2 % agarose gel and then purified using the QIAquick QiageneTM kit according to the manufacturer’s instructions. Last, 16 μL of the PCR products (150 ng μL-1) of each isolate were sequenced using the forward and reverse primers (Biotechnology Institute, UNAM). The sequences were edited and assembled using DNASTAR SEQman II ver. 5.06 software, and low-quality sequences were eliminated. Using the basic local alignment search tool (BLAST), the sequences were analyzed and compared with those registered in the National Center for Biotechnology Information (NCBI) database to identify their similarity. Finally, the sequences were submitted to the NCBI database.

Statistical analysis. To analyze the data, a two-way analysis of variance (ANOVA) assay was performed. The test considered rhizosheath soil and soil not adhered by roots (loose soil), and the cropping period (four dates: sowing; flowering; harvest, and post-harvest) as factors. When statistically significant differences were detected (p < 0.05), the Tukey mean comparison test was carried out. JMP® 8.0 statistical software was employed.


Properties in the rhizosphere of Amaranthus hypochondriacus. Soil organic carbon (SOC) content and total nitrogen (TN) were significantly higher in rhizosheath soil compared with samples of loose soil, but non-differences were observed concerning microbial biomass carbon (Cmic) even if higher levels were present in loose soil (Table 1). pH and soil water content (SWC) did not exhibit differences between rhizosheath soil and loose soil, which was also observed concerning the six enzyme activities (Table 1). At sowing date roots were not yet developed; by analyzing the other three sampling seasons (flowering, harvest, and post-harvest where the plant roots remained into the soil), TN was always higher in rhizosheath than in loose soil, as well as SOC in flowering and post-harvest seasons; Cmic was three-times higher in loose than in rhizosheath soil in post-harvest season (Table 2). pH and SWC were measured without discriminate between both microenvironments; pH did not show differences between phenological stages, while SWC decreased from 20 g 100 g-1 in sowing to 4.9 g 100 g-1 in post-harvest. Concerning enzyme activity, DH exhibited highest values in post-harvest season compared with the previous two seasons, with differences between the two soil types at harvest and post-harvest stages. ACP demonstrated a tendency to increase as the farming season progressed, and no differences between rhizosphere and loose soils occurred, while ALP showed differences between the two soil types only at the flowering season. CEL showed low values in all three sampling seasons. CHI had similar values in the flowering and harvest seasons without differences between soil types, with a slight decrease in post-harvest season, during which rhizosheath soil was nearly double compared with loose soil. Finally, PRO exhibited differences between soil types at harvest season, with the higher mean for rhizosheath soil (Table 2).

Table 1

Properties and potential enzyme activities in rhizosheath of Amaranthus hypochondriacus, and loose soils (mean±standard error; n = 9). Different letters indicate different mean groups (p < 0.05).

Rhizosheath Loose soil
Soil properties
Soil organic carbon (mg 100 g-1) 0.71±0.05a 0.41±0.03b
Microbial biomass carbon (mg kg-1) 213.28±29.45a 284.61±33.66a
Total nitrogen (mg 100 g-1) 0.14±0.00a 0.04±0.01b
pH 7.1±0.03a 7.1±0.03a
Soil water content (g 100 g-1) 10.43±2.06a 9.81±1.83a
Potential enzyme activity
Dehydrogenase (µM INTF g-1 h-1) 5.01±0.63a 5.31±0.40a
Acid phosphatase (µM p-nitrophenol g-1 h-1) 0.96±0.04a 0.93±0.05a
Alkaline phosphatase (µM p-nitrophenol g-1 h-1) 1.16±0.06a 1.28±0.05a
Cellulase (µM equivalent glucose g-1 h-1) 0.01±0.00a 0.00±0.00a
Chitinase (µM N-acetylglucosamine g-1 h-1) 12.25±2.88a 7.96±2.48a
Protease (µM tyrosine g-1 h-1) 13.75±11.38a 9.89±4.24a

Table 2

Properties and potential enzyme activities in rhizosheath of Amaranthus hypochondriacus in every phenological stage, and loose soils (mean±standard error; n = 3). Different letters indicate different mean groups (Tukey; p < 0.05).

Sowing Flowering Harvest Post-harvest
Base line Rhizosheath Loose soil Rhizosheath Loose soil Rhizosheath Loose soil
Soil properties
Soil organic carbon
(mg 100 g-1)
0.48±0.00 0.89±0.00a 0.29±0.01b 0.53±0.01a 0.52±0.01a 0.69±0.00a 0.41±0.01b
Microbial biomass carbon
(mg kg-1)
183.7±62.8 262.5±26.8a 179.7±24.0a 260.6±46.1a 291.1±15.7a 116.8±24.3b 383.0±49.1a
Total nitrogen
(mg 100 g-1)
0.11±0.00 0.16±0.00a 0.10±0.00b 0.16±0.00a 0.01±0.00b 0.11±0.00a 0.00±0.00b
pH 7.9±0.03 7.1±0.04a 7.1±0.02a 7.2±0.04a
Soil water content
(g 100 g-1)
20.4±0.24 17.5±0.90a 7.9±0.06b 4.9±0.05c
Potential enzyme activity
(µM INTF g-1 h-1)
6.94±0.07 5.03±0.26a 5.45±0.82a 2.04±0.36b 3.91±0.24a 7.97±0.28a 6.56±0.37b
Acid phosphatase
(µM p-nitrophenol g-1 h-1)
0.42±0.10 0.81±0.01a 0.72±0.06a 0.86±0.00a 0.93±0.04a 1.21±0.02a 1.12±0.02a
Alkaline phosphatase
(µM p-nitrophenol g-1 h-1)
0.80±0.06 1.06±0.04b 1.28±0.03a 0.94±0.03a 1.10±0.07a 1.48±0.02a 1.46±0.03a
(µM equivalent glucose g-1 h-1)
0.064±0.00 0.014±0.00a 0.006±0.00a 0.008±0.00a 0.012±0.00a 0.010±0.00a 0.005±0.00a
(µM N-acetylglucosamine g-1 h-1)
13.28±3.11 13.16±6.51a 5.44±2.57a 13.80±5.33a 13.04±6.43a 9.78±4.69a 5.41±2.55a
(µM tyrosine g-1 h-1)
8.51±0.99 25.62±6.02a 17.48±11.28a 12.79±1.03a 2.18±1.77b 2.85±2.28a 10.00±5.22a

Correlation analysis between all variables measured in this study is shown in Table 3. ACP and ALP activities showed negative and significant correlation with soil pH and SWC. CEL activity had positive and significant correlation with pH and SWC. Finally, a positive correlation between PRO activity and SWC was observed. None of the six enzymatic activities showed significant correlation with Cmic, SOC, or TN (Table 3).

Table 3

Pearson correlation coefficient of overall soil variables measured in rhizosheath and loose soils of Amaranthus hypochondriacus (n = 12).

pH 1.00
SWC 0.53* 1.00
SOC -0.13 0.07 1.00
TN 0.08 0.43 0.48* 1.00
DH 0.43 0.06 0.01 -0.19 1.00
ACP -0.66** -0.84** 0.18 -0.30 0.15 1.00
ALP -0.46* -0.54* -0.11 -0.41 0.39 0.77** 1.00
CEL 0.91** 0.59* -0.02 0.14 0.30 -0.70** -0.63* 1.00
CHI 0.14 0.10 0.26 0.21 -0.11 -0.06 -0.30 0.28 1.00
PRO -0.12 0.46* 0.22 0.37 -0.14 -0.16 -0.09 -0.07 0.11 1.00
Cmic -0.25 -0.22 -0.12 -0.42 -0.22 0.24 0.08 -0.22 -0.06 0.12 1.00

[i] SWC, soil water content; SOC, soil organic carbon; TN, total nitrogen; DH, dehydrogenase; ACP, acid phosphatase; ALP, alkaline phosphatase; CEL, cellulase; CHI, chitinase; PRO, protease; Cmic, microbial biomass carbon; *, **, significant at p < 0.05 and p < 0.01, respectively.

Molecular identification of bacterial isolates. Partial sequences of the 16S rDNA segments of each bacterial isolate were submitted to the GenBank database at NCBI (Table 4). Predominant genera found during the four sampling seasons included Bacillus (29 isolates), followed by Enterobacter (3 isolates), Streptomyces (2 isolates), Stenotrophomonas (1 isolate), Pseudomonas (1 isolate), and Arthrobacter (1 isolate). Streptomyces was detected only during the sowing season. In summary, the flowering season showed highest bacterial diversity, whereas the harvest season had lowest bacterial diversity.

Table 4

Molecular identification based on the 16S rDNA segment of 37 bacterial strains from rhizosheath soil of Amaranthus hypochondriacus and their potential roles.

Strain Accesion number in the GenBank Highest homology (accesion number in the GenBank) Potential role in the soil (references)
AN1E1 KC336020 Streptomyces zaomyceticus (EU593685) Degradation of recalcitrant organic matter, cellulolytic activity (a, b, e)
AN3E1a KC336021 Bacillus sp. (AB773240) P solubilization (a, b, e)
AN4E1a KC336022 Bacillus sp. (JN132107) P solubilization (a, b, e)
AN5E1b KC336024 Bacillus sp. (HQ600985) P solubilization (a, b, e)
AS1E1 KC336025 Bacillus cereus (EU661712) P solubilization, PGPR (a, b, e)
AS2E1b KC336027 Streptomyces sp. (JQ812096) Degradation of recalcitrant organic matter, cellulolytic activity (a, b, e)
AS4E1b KC336029 Bacillus sp. (JN872500) P solubilization (a, b, e)
AS5E1a KC336030 Bacillus cereus (JX855262) P solubilization, PGPR (a, b, e)
AN1E2 KC336032 Bacillus sp. (JX402435) P solubilization, PGPR (a, b, e)
AN2E2 KC336033 Bacillus sp. (JQ396537) P solubilization, PGPR (a, b, e)
AN3E2 KC336034 Enterobacter sp. (EU331414) PGPR (a, c)
AN4E2 KC336035 Stenotrophomonas sp. (AY689048) Chitinolytic activity, degradation of xenobiotics (a, b)
AN5E2 KC336036 Bacillus cereus (EF488087) P solubilization, PGPR (a, b)
AS1E2 KC336037 Pseudomonas sp. (HQ224640) PGPR (a, b)
AS2E2b KC336039 Enterobacter sp. (HQ677832) PGPR (a, c)
AS3E2a KC336040 Enterobacter sp. (GU272374) PGPR (a, c)
AS4E2a KC336042 Bacillus sp. (JN210907) P solubilization, PGPR (a, b, e)
AS5E2a KC336044 Bacillus sp. (KC121044) P solubilization, PGPR (a, b)
AN1E3 KC336046 Bacillus subtilis (HM744709) P solubilization, biological control, amylase and cellulase production (a, b, e)
AN2E3 KC336047 Bacillus pumilus (JX847116) P solubilization, PGPR (a, b, e)
AN3E3a KC336048 Bacillus pumilus (JX625990) P solubilization, PGPR (a, b, e)
AN4E3 KC336050 Bacillus pumilus (JN082266) P solubilization, PGPR (a, b, e)
AN5E3 KC336051 Bacillus pumilus (HQ218989) P solubilization, PGPR (a, b, e)
AS1E3 KC336052 Bacillus megaterium (AB738793) P solubilization, PGPR (a, b, e)
AS2E3 KC336053 Bacillus megaterium (AB738793) P solubilization, PGPR (a, b, e)
AS3E3 KC336054 Bacillus aryabhattai (JX460818) P solubilization, PGPR (a, b, e)
AS4E3 KC336055 Bacillus megaterium (JX312585) P solubilization, PGPR (a, b, e)
AN1E4b KC336057 Bacillus sp. (JX897963) P solubilization, PGPR (a, b)
AN2E4b KC336059 Bacillus sp. (JX566587) P solubilization, PGPR (a, b)
AN3E4b KC336061 Bacillus cereus (JX273683) P solubilization, PGPR (a, b, e)
AN4Eb KC336062 Arthrobacter sp. (JF768708) Degradation of xenobiotics (d)
AN5E4b KC336064 Bacillus sp. (JX266343) P solubilization, PGPR (a, b)
AS1E4 KC336065 Bacillus sp. (HM104462) P solubilization, PGPR (a, b)
AS2E4 KC336066 Bacillus megaterium (AB738793) P solubilization, PGPR (a, b, e)
AS3E4 KC336067 Bacillus sp. (JF309237) P solubilization, PGPR (a, b)
AS4E4a KC336068 Bacillus megaterium (HM357355) P solubilization, PGPR (a, b, e)
AS5E4 KC336070 Bacillus aryabhattai (JX460818) P solubilization, PGPR (a, b, e)

[i] Strain names were reported by Moreno-Espíndola et al. (2013); PGPR, plant growth-promoting rhizobacteria. References: a) Andrade (2004), b) Yang et al. (2012), c) Schütz et al. (2003), d) Vaishampayan et al. (2007), e) Yasir et al. (2009).


The similarity in the general potential enzyme activity in rhizosheath and loose soils indicate biochemical likeness in both microenvironments in the amaranth rhizosphere. This could be explained by the dominant mineral in soil, pumice, which favor equality in water-retention capacity in both soil types (Segura-Castruita et al. 2005), and, by the presence of abundant hyphae in association with the amaranth roots in the same soil (Moreno-Espíndola et al. 2007), which increases the influence zone of the roots. Othman et al. (2004) reported that in the rhizosheaths of two grasses (Panicum turgidum and Stipagrostis scoparia), SOC and TN were two-fold higher than in loose soil. This result is consistent with the fact that grasses are not exposed to mechanical tillage, which allows the accumulation of exudates and organic matter. In our study, the amaranth crop was established with minimum tillage, which favor microbial growth and potential enzymatic activity in the loose soil located in the vicinity of the main root zone.

When comparing potential enzymatic activity between rhizosheath and loose soils for each cropping period, significant statistical differences were found. These results confirm the role of DH activity as a sensitive agronomic indicator (Fuentes-Ponce et al. 2016); in the current study, DH changed with phenological stage and soil microenvironment. Likewise, higher ALP activity during the flowering period in loose soil in comparison with rhizosheath soil coincides with the larger area of influence attributed to this enzyme, which is produced only by microorganisms and not by roots (Spohn & Kuzyakov 2013). Activities of DH and both phosphatases were highest during the post-harvest stage. One factor that may intervene in higher enzyme activity during post-harvest period is the soil-atmosphere gas exchange. It is assumed that, as the soil dries the water-free pores are filled with air and further shrinkage of root and post-harvest root decay increase the number of pores that can be filled with air. Such conditions favor aerobic respiration and increase DH activity during post-harvest. The effects of these changes on rhizosphere conditions over time were also observed in ACP and ALP, which increased as each period elapsed, while CEL behavior was contrariwise. In the current study, the slow degradation rate of cellulose-rich residues is due to a decrease in soil moisture during the dry season and low temperatures during winter. These climatic conditions can explain the low levels of CEL activity, which are mainly driven by anaerobic bacteria. Moreno-Espíndola et al. (2007) reported high soil porosity in this same soil, which could increase O2 availability, resulting in possible inhibition of cellulolytic microbial groups, hence, of their activity. Moreover, Yaroslavtsev et al. (2009) reported that a decrease in soil moisture promoted CHI activity in sandy soils. In contrast, we found a decrease in CHI activity when SWC decreased. SOC and TN results showed that rhizosheaths possessed more favorable conditions for soil organic matter (SOM) accumulation.

In a semi-arid region, plant species increased the organic matter content in their rhizospheres, where enzymes such as phosphatase and urease increased their activity in contrast to a soil without vegetation; rhizosphere induces the synthesis of such enzymes (Garcia et al. 2005). Other semi-arid degraded soil, amended with compost, improved soil water holding capacity, which in turn increased activity of β-glucosidase, phosphatase and DH (Hernández et al. 2015). These results reinforce the need to study the rhizosphere footprint of plant species and the microbial ecology process (York et al. 2016).

In the microbiome identified, the Bacillus genus was the most abundant. During the crop-sowing stage CEL activity was highest, which was consistent with the presence of Streptomyces isolates that play a significant role in aerobic cellulose degradation (Andrade 2004). High cellulose accumulation in soil derives from root tissues of amaranth from the last post-harvest period. During the post-harvest season when phosphatase activities (ALP and ACP) were highest, the bacterial species Arthrobacter spp., Bacillus cereus, B. megaterium, and B. aryabhattai were found. These species have been reported as phosphate-solubilizing bacteria (Yang et al. 2012).

In the present study, highest bacterial diversity was observed during the flowering period which can be related, in part, with the unique fertilization dose applied to the soil, while, during crop harvest, Bacillus was the sole genus present. Stenotrophomonas has been reported as rhizosphere inhabitant cohabiting with Bacillus and Pseudomonas, and their presence is influenced by plant type and by carbon sources (Kapoor & Mukerji 2006). These genera have also been reported as plant growth-promoting rhizobacteria (PGPR) because they produce and release growth hormones (Schütz et al. 2003). The soil bacterial strains identified in the current study have a potential in biotechnological uses (i.e., native microbial consortia useful for biological soil fertility) and for cropping amaranth and other plants under the concept of sustainability (Scotti et al. 2015) in semi-arid conditions.

In conclusion, in the rhizosphere of Amaranthus hypochondriacus grown in a pumiceous sandy soil, potential enzymatic activities in the rhizosheath and loose soils were similar, which must be considered a unique rhizosphere environment. Dehydrogenase and acid phosphatase activities are highly sensitive to changes in the crop phenology. Acid and alkaline phosphatase, cellulose and protease activities correlated to changes in soil moisture. The behavior of phosphatases and dehydrogenase activities suggests a process of active degradation of organic materials and increased dynamic SOM during the post-harvest period. In the amaranth rhizosphere, native bacteria are involved in the breakdown of SOM and they possess potential for biotechnological applications for agriculture as inoculants for the design of novel biological inputs. Other molecular biology methods should be employed for the study of total microbial diversity.


We would like to thank CONACyT (Mexico) for funding this research and for the scholarship awarded to I.P. Moreno-Espíndola (Number: 28573) for doctoral studies. We also thank Lidia I. Leal-Guadarrama (PROBIOMED) and Gilberto Vela-Correa (UAM-Xochimilco) for support during bioinformatics and soil analysis, respectively. Two anonymous reviewers and the Editor improved the manuscript.

Literature cited


Andrade G. 2004. Role of functional groups of microorganisms on the rhizosphere microcosm dynamics. In: Varma A, Abbott L, Werner D, Hampp R. Eds. Plant Surface Microbiology. Berlin Heidelberg: Springer-Verlag, 51-69. ISBN: 978-3-540-00923-8

G Andrade 2004Role of functional groups of microorganisms on the rhizosphere microcosm dynamics A Varma L Abbott D Werner R Hampp Plant Surface MicrobiologyBerlin HeidelbergSpringer-Verlag5169978-3-540-00923-8


Barba de la Rosa AP, Fomsgaard IS, Laursen B, Mortensen AG, Olvera-Martínez L, Silva-Sánchez C, Mendoza-Herrera A, González-Castañeda J, De León-Rodríguez A. 2009. Amaranth (Amaranthus hypochondriacus) as an alternative crop for sustainable food production: Phenolic acids and flavonoids with potential impact on its nutraceutical quality. Journal of Cereal Science 49: 117-121. DOI:

AP Barba de la Rosa IS Fomsgaard B Laursen AG Mortensen L Olvera-Martínez C Silva-Sánchez A Mendoza-Herrera J González-Castañeda A De León-Rodríguez 2009Amaranth (Amaranthus hypochondriacus) as an alternative crop for sustainable food production: Phenolic acids and flavonoids with potential impact on its nutraceutical qualityJournal of Cereal Science4911712110.1016/j.jcs.2008.07.012


Bencherif K, Boutekrabt A, Dalpé Y, Lounès-Hadj-Sahraoui K. 2016. Soil and season affect arbuscular mycorrhizal fungi associated with Tamarix rhizosphere in arid and semi-arid steppes. Applied Soil Ecology 107: 182-190. DOI:

K Bencherif A Boutekrabt Y Dalpé K Lounès-Hadj-Sahraoui 2016Soil and season affect arbuscular mycorrhizal fungi associated with Tamarix rhizosphere in arid and semi-arid steppesApplied Soil Ecology10718219010.1016/j.apsoil.2016.06.003


Bremner JM, Mulvaney CS. 1982. Nitrogen-total. In: Page AL, Miller RH, Keeney DR. Eds. Methods of Soil Analysis. Part 2. Chemical and Microbiological Properties. Madison: American Society of Agronomy, 595-622. ISBN: 0-89118-072-9

JM Bremner CS Mulvaney 1982Nitrogen-total AL Page RH Miller DR Keeney Methods of Soil Analysis. Part 2. Chemical and Microbiological PropertiesMadisonAmerican Society of Agronomy5956220-89118-072-9


Clouse JW, Adhikary D, Page JT, Ramaraj T, Deyholos MK, Udall JA, Fairbanks DJ, Jellen EN, Maughan PJ. 2016. The amaranth genome: genome, transcriptome, and physical map assembly. The Plant Genome 9: 1-14. DOI:

JW Clouse D Adhikary JT Page T Ramaraj MK Deyholos JA Udall DJ Fairbanks EN Jellen PJ Maughan 2016The amaranth genome: genome, transcriptome, and physical map assemblyThe Plant Genome911410.3835/plantgenome2015.07.0062


De León-González F, Celada-Tornel E, Hidalgo-Moreno CI, Etchevers-Barra JD, Gutiérrez-Castorena MC, Flores-Macías A. 2006. Root-soil adhesion as affected by crop species in a volcanic sandy soil of Mexico. Soil & Tillage Research 90: 77-83. DOI:

F De León-González E Celada-Tornel CI Hidalgo-Moreno JD Etchevers-Barra MC Gutiérrez-Castorena A Flores-Macías 2006Root-soil adhesion as affected by crop species in a volcanic sandy soil of MexicoSoil & Tillage Research90778310.1016/j.still.2005.08.007


Francioli D, Schulz E, Buscot F, Reitz T. 2018. Dynamics of soil bacterial communities over a vegetation season relate to both soil nutrient status and plant growth phenology. Microbial Ecology 75: 216-227. DOI:

D Francioli E Schulz F Buscot T Reitz 2018Dynamics of soil bacterial communities over a vegetation season relate to both soil nutrient status and plant growth phenologyMicrobial Ecology7521622710.1007/s00248-017-1012-0


Fuentes-Ponce M, Moreno-Espíndola IP, Sánchez-Rodríguez LM, Ferrara-Guerrero MJ, López-Ordaz R. 2016. Dehydrogenase and mycorrhizal colonization: Tools for monitoring agrosystem soil quality. Applied Soil Ecology 100: 144-153. DOI:

M Fuentes-Ponce IP Moreno-Espíndola LM Sánchez-Rodríguez MJ Ferrara-Guerrero R López-Ordaz 2016Dehydrogenase and mycorrhizal colonization: Tools for monitoring agrosystem soil qualityApplied Soil Ecology10014415310.1016/j.apsoil.2015.12.011


Garcia C, Roldan A, Hernandez T. 2005. Ability of different plant species to promote microbiological processes in semiarid soil. Geoderma 124: 193-202. DOI:

C Garcia A Roldan T Hernandez 2005Ability of different plant species to promote microbiological processes in semiarid soilGeoderma12419320210.1016/j.geoderma.2004.04.013


García C, Gil F, Hernández T, Trasar C. 2003. Técnicas de Análisis de Parámetros Bioquímicos en Suelos: Medida de Actividades Enzimáticas y Biomasa microbiana. Madrid: Mundi-Prensa. ISBN: 9788484761549

C García F Gil T Hernández C Trasar 2003Técnicas de Análisis de Parámetros Bioquímicos en Suelos: Medida de Actividades Enzimáticas y Biomasa microbianaMadridMundi-Prensa9788484761549


Gianfreda L. 2015. Enzymes of importance to rhizosphere processes. Journal of Soil Science and Plant Nutrition 2: 283-306. DOI:

L Gianfreda 2015Enzymes of importance to rhizosphere processesJournal of Soil Science and Plant Nutrition228330610.4067/S0718-95162015005000022


Hernández T, Garcia E, García C. 2015. A strategy for marginal semiarid degraded soil restoration: a sole addition of compost at a high rate. A five-year field experiments. Soil Biology & Biochemistry 89: 61-71. DOI:

T Hernández E Garcia C García 2015A strategy for marginal semiarid degraded soil restoration: a sole addition of compost at a high rate. A five-year field experimentsSoil Biology & Biochemistry89617110.1016/j.soilbio.2015.06.023


Kapoor R, Mukerji KG. 2006. Rhizosphere microbial community dynamics. In: Mukerji KG, Manoharachary C, Singh J. Eds. Microbial Activity in the Rhizosphere, pp. 55-66, Springer-Verlag, Berlin Heidelberg. ISBN: 978-3-540-29182-4

R Kapoor KG Mukerji 2006Rhizosphere microbial community dynamics KG Mukerji C Manoharachary J Singh Microbial Activity in the Rhizosphere5566Springer-VerlagBerlin Heidelberg978-3-540-29182-4


Kuddus SM, Ahmad RIZ. 2013. Isolation of novel chitinolytic bacteria and production optimization of extracellular chitinase. Journal of Genetic Engineering and Biotechnology 11: 39-46. DOI:

SM Kuddus RIZ Ahmad 2013Isolation of novel chitinolytic bacteria and production optimization of extracellular chitinaseJournal of Genetic Engineering and Biotechnology11394610.1016/j.jgeb.2013.03.001


Laguerre G, Allard M-R, Revoy F, Amarger N. 1994. Rapid identification of rhizobia by restriction fragment length polymorphism analysis of PCR-amplified 16S rRNA genes. Applied and Environmental Microbiology 60: 56-63.

G Laguerre M-R Allard F Revoy N Amarger 1994Rapid identification of rhizobia by restriction fragment length polymorphism analysis of PCR-amplified 16S rRNA genesApplied and Environmental Microbiology605663


Lesuffleur F, Paynel F, Bataillé M-P, Le Deunff E, Cliquet JB. 2007. Root amino acid exudation: measurement of high efflux rates of glycine and serine from six different plant species. Plant and Soil 294: 235-246. DOI:

F Lesuffleur F Paynel M-P Bataillé E Le Deunff JB Cliquet 2007Root amino acid exudation: measurement of high efflux rates of glycine and serine from six different plant speciesPlant and Soil29423524610.1007/s11104-007-9249-x


Moreno-Espíndola IP, Ferrara-Guerrero MJ, De León-González F, Rivera-Becerril F, González-Halphen D. 2013. Comunidad bacteriana cultivable asociada a la rizocoraza de Amaranthus hypochondriacus. Terra Latinoamericana 31: 57-69.

IP Moreno-Espíndola MJ Ferrara-Guerrero F De León-González F Rivera-Becerril D González-Halphen 2013Comunidad bacteriana cultivable asociada a la rizocoraza de Amaranthus hypochondriacusTerra Latinoamericana315769


Moreno-Espíndola IP, Rivera-Becerril F, Ferrara-Guerrero MJ, De León-González F. 2007. Role of root-hairs and hyphae in adhesion of sand particles. Soil Biology and Biochemistry 39: 2520-2526. DOI:

IP Moreno-Espíndola F Rivera-Becerril MJ Ferrara-Guerrero F De León-González 2007Role of root-hairs and hyphae in adhesion of sand particlesSoil Biology and Biochemistry392520252610.1016/j.soilbio.2007.04.021


Othman AA, Amer WM, Fayez M, Hegazi NA. 2004. Rhizosheath of Sinai desert plants is a potential repository for associative diazotrophs. Microbiological Research 159: 285-293. DOI:

AA Othman WM Amer M Fayez NA Hegazi 2004Rhizosheath of Sinai desert plants is a potential repository for associative diazotrophsMicrobiological Research15928529310.1016/j.micres.2004.05.004


Pal SS. 1998. Interactions of an acid tolerant strain of phosphate solubilizing bacteria with a few acid tolerant crops. Plant and Soil 198: 169-177. DOI:

SS Pal 1998Interactions of an acid tolerant strain of phosphate solubilizing bacteria with a few acid tolerant cropsPlant and Soil19816917710.1023/A:1004318814385


Parra-Cota FI, Peña-Cabriales JJ, de los Santos-Villalobos S, Martínez-Gallardo NA, Délano-Frier JP. 2014. Burkholderia ambifaria and B. caribensis promote growth and increase yield in grain amaranth (Amaranthus cruentus and A. hypochondriacus) by improving plant nitrogen uptake. PLOS ONE 9: e88094. DOI:

FI Parra-Cota JJ Peña-Cabriales S de los Santos-Villalobos NA Martínez-Gallardo JP Délano-Frier 2014Burkholderia ambifaria and B. caribensis promote growth and increase yield in grain amaranth (Amaranthus cruentus and A. hypochondriacus) by improving plant nitrogen uptakePLOS ONE9e8809410.1371/journal.pone.0088094


Philippot L, Kuffner M, Chèneby D, Depret G, Laguerre G, Martin-Laurent F. 2006. Genetic structure and activity of the nitrate-reducers community in the rhizosphere of different cultivars of maize. Plant and Soil 287: 177-186. DOI:

L Philippot M Kuffner D Chèneby G Depret G Laguerre F Martin-Laurent 2006Genetic structure and activity of the nitrate-reducers community in the rhizosphere of different cultivars of maizePlant and Soil28717718610.1007/s11104-006-9063-x


Schütz A, Golbik R, Tittmann K, Svergun DI, Koch MHJ, Hübner G, König S. 2003. Studies on structure-function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway. European Journal of Biochemistry 270: 2322-2331. DOI:

A Schütz R Golbik K Tittmann DI Svergun MHJ Koch G Hübner S König 2003Studies on structure-function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathwayEuropean Journal of Biochemistry2702322233110.1046/j.1432-1033.2003.03602.x


Scotti R, Bonanomi G, Scelza R, Zoina A, Rao MA. 2015. Organic amendments as sustainable tool to recovery fertility in intensive agricultural systems. Journal of Soil Science and Plant Nutrition 15: 333-352. DOI:

R Scotti G Bonanomi R Scelza A Zoina MA Rao 2015Organic amendments as sustainable tool to recovery fertility in intensive agricultural systemsJournal of Soil Science and Plant Nutrition1533335210.4067/S0718-95162015005000031


Segura-Castruita MA, Gutiérrez-Castorena MC, Ortiz-Solorio CA, Sánchez-Guzmán P. 2005. Régimen de humedad y clasificación de suelos pomáceos del Valle Puebla-Tlaxcala. Terra Latinoamericana 23: 13-20.

MA Segura-Castruita MC Gutiérrez-Castorena CA Ortiz-Solorio P Sánchez-Guzmán 2005Régimen de humedad y clasificación de suelos pomáceos del Valle Puebla-TlaxcalaTerra Latinoamericana231320


Soil Survey Staff. 2003. Soil taxonomy. Natural Resources Conservation Service, Washington.

Staff Soil Survey 2003Soil taxonomyNatural Resources Conservation ServiceWashington


Spohn M, Kuzyakov Y. 2013. Distribution of microbial- and root-derived phosphatase activities in the rhizosphere depending on P availability and C allocation - Coupling soil zymography with 14C imaging. Soil Biology and Biochemistry 67: 106-113. DOI:

M Spohn Y Kuzyakov 2013Distribution of microbial- and root-derived phosphatase activities in the rhizosphere depending on P availability and C allocation - Coupling soil zymography with 14C imagingSoil Biology and Biochemistry6710611310.1016/j.soilbio.2013.08.015


Vaishampayan PA, Kanekar PP, Dhakephalkar PK. 2007. Isolation and characterization of Arthrobacter sp. strain MCM B-436, an atrazine-degrading bacterium, from rhizospheric soil. International Biodeterioration & Biodegradation 60: 273-278. DOI:

PA Vaishampayan PP Kanekar PK Dhakephalkar 2007Isolation and characterization of Arthrobacter sp. strain MCM B-436, an atrazine-degrading bacterium, from rhizospheric soilInternational Biodeterioration & Biodegradation60:27327810.1016/j.ibiod.2007.05.001


Vance ED, Brookes PC, Jenkinson DS. 1987. An extraction method for measuring soil microbial biomass C. Soil Biology and Biochemistry 19: 703-707. DOI:

ED Vance PC Brookes DS Jenkinson 1987An extraction method for measuring soil microbial biomass CSoil Biology and Biochemistry1970370710.1016/0038-0717(87)90052-6


Walkley A, Black IA. 1934. An examination of the Degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration method. Soil Science 37: 29-38. DOI:

A Walkley IA Black 1934An examination of the Degtjareff method for determining soil organic matter, and a proposed modification of the chromic acid titration methodSoil Science37:293810.1097/00010694-193401000-00003


Yang P-X, Ma L, Chen M-H, Xi J-Q, He F, Duan C-Q, Mo M-H, Fang D-H, Duan Y-Q, Yang F-X. 2012. Phosphate solubilizing ability and phylogenetic diversity of bacteria from P-rich soils around Dianchi Lake drainage area of China. Pedosphere 22: 707-716. DOI:

P-X Yang L Ma M-H Chen J-Q Xi F He C-Q Duan M-H Mo D-H Fang Y-Q Duan F-X Yang 2012Phosphate solubilizing ability and phylogenetic diversity of bacteria from P-rich soils around Dianchi Lake drainage area of ChinaPedosphere2270771610.1016/S1002-0160(12)60056-3


Yaroslavtsev AM, Manucharova NA, Stepanov AL, Zvyagintsev DG, Sudnitsyn II. 2009. Microbial destruction of chitin in soils under different moisture conditions. Eurasian Soil Science 42: 797-806. DOI:

AM Yaroslavtsev NA Manucharova AL Stepanov DG Zvyagintsev II Sudnitsyn 2009Microbial destruction of chitin in soils under different moisture conditionsEurasian Soil Science4279780610.1134/S1064229309070114


Yasir M, Aslam Z, Kim SW, Lee S-W, Jeon CO, Chung YR. 2009. Bacterial community composition and chitinase gene diversity of vermicompost with antifungal activity. Bioresource Technology 100: 4396-4403. DOI:

M Yasir Z Aslam SW Kim S-W Lee CO Jeon YR Chung 2009Bacterial community composition and chitinase gene diversity of vermicompost with antifungal activityBioresource Technology1004396440310.1016/j.biortech.2009.04.015


York LM, Carminati A, Mooney SJ, Ritz K, Bennett MJ. 2016. The holistic rhizosphere: integrating zones, processes, and semantics in the soil influenced by roots. Journal of Experimental Botany 67: 3629-3643. DOI:

LM York A Carminati SJ Mooney K Ritz MJ Bennett 2016The holistic rhizosphere: integrating zones, processes, and semantics in the soil influenced by rootsJournal of Experimental Botany673629364310.1093/jxb/erw108


3 Associated editor: Silvia Aguilar Rodríguez

Desarrollado por eScire - Consultoría, Tecnologías y Gestión del Conocimiento SA de CV

Article Metrics

Abstract Views.
Total number of Abstract Views for this article.
a description of the source 416
This journal

Metrics Loading ...

Metrics powered by PLOS ALM


  • There are currently no refbacks.


Botanical Sciences is an international peer-reviewed journal that publishes scientific papers in plant sciences. The arguments, figures / schemes / photographs, quality and the general contents of this publication are full responsibility of the authors, and not commit the Editor- in-Chief or the Sociedad Botánica de México.

Botanical Sciences year 8, Vol. 97, No. 1, January-March 2019. Quarterly publication edited and published by Sociedad Botánica de México A.C. ( Editor in Chief Salvador Arias, Jardín Botánico, Instituto de Biología, 3er Circuito s/n, Ciudad Universitaria, Delegación Coyoacán, C.P. 04510. Reserves of Rights to the Exclusive Use No. 04-2017-040716054100-203, digital-ISSN 2007-4476, both granted by the Instituto Nacional del Derecho de Autor. Responsible for updating the page Pedro López, email:, eScire. Last update March 11, 2019.

Creative Commons License This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.



website counter